Flight Of The Phoenix Essays - Social Psychology, Social Groups

Flight of the Phoenix Flight of the Phoenix is a movie that displays the dynamics of a group in terms of power, decision-making, communication, group roles, group atmosphere and norms, and leadership in the group. The movie's story line follows a diverse group of oil workers, military men, a doctor, a pilot and a navigator among others that sets out on a rickety plane to cross the Arabian Desert. Not long into the flight the plane is caught between two sand storms and is blow off course. The plane in forced to crash land and a few passenger die. The severity of the situation that the men find themselves in forces them to form a group. The newly formed group confronts several challenges, tasks and goals immediately after they find themselves stranded in the desert with limited resources. The member's begin to adopt specific group roles, as well as follow various stages of group development. One theory of group development explains how new groups do not immediately function as highly effective teams until they have gone through various stages of development. These stages are given mnemonic names that are as easy to understand, as they are to remember; the names of the stages are, Forming, Storming, Norming, and Preforming. Forming The decision making process in the forming stage of a group is usually manifest by caution, confusion, courtesy, and commonality. These characteristics may vary throughout the group depending on their intimacy and the influence of the leader. These characteristics were truly apparent in Flight of the Phoenix. When the airplane crash-landed in the scorching and searing desert confusion erupted, passengers fled for safety. In a confused and puzzled manner, members of this bewildered group huddled under the wing of the mother plane seeking refuge and direction from their grand captain, the pilot Frank Towns. The decisions initially made at this climax rooted the first seeds of the groups' orientation and eventually forming. Initially they unofficially made Towns their leader. In this early choice many were cautious but willing, most just showed a common courtesy to his position as pilot and followed, while others like the military captain Harris, in a heroic effort, seized his chance to demonstrate differently. Each individual decision made on behalf of the member influence the final effectiveness of the organization. Storming While stranded in the desert the group underwent a phase in their group dynamics in which confrontation, disagreement, and criticism arose. This is particularly evident in the way they communicated among each other. Furthermore, the expectations of the group members were also questioned when the shift of leadership went from the pilot Towns to an airplane designer named Dorfman. This challenging phase proved to beneficial because it provided greater cohesiveness and brought them closer to their ultimate goal of survival. A falling out transpired when the military sergeant named Watson was unable to communicate his aversion for the army to his commanding officer, Captain Harris. As Captain Harris was forming an exploration team Watson faked a leg injury to disqualify him from the group. This nonverbal communication alerted every one of Watson's feelings about being treated as a subordinate. This eventually led to a verbal argument that dichotomized Watson and Captain Harris. This challenge to Captain Harris' role as the authoritative military man is a common occurrence during the storming phase. The major confrontation occurred when two individuals struggled for the leadership position. The pilot Towns originally filled the leadership role, and had the duty of the principal organizer and figurehead of the group. Everyone looked to him for direction. He took on the role because of his superior knowledge of aircraft accidents and the group trusted him to provide a way for their rescue. However, the real reason for Towns' leadership was because he felt personal responsibility for the crash of the plane. Later we saw a dramatic shift in leadership when airplane designer Dorfman came up with a plan to rebuild a plane and then fly them to safety. This made an abrupt transfer in the decision making process from Towns to Dorfman as the leader. It became necessary for the success of the group that Towns publicly recognized Dorfman as leader. Much to Towns' chagrin he did so and let Dorfman believe

How to Get Good Grades in Business School

How to Get Good Grades in Business School Every business school works differently when it comes to grades. Some grading systems are based on instructional approaches. For example, lecture-based courses sometimes base grades on class assignments or test scores. Programs that use the case method, like Harvard School of Business, often base a percentage of your grade on classroom participation. In some cases, schools wont even award traditional grades. Yale School of Management, for example, has grading categories like Distinction, Proficient, Pass, and Fail. Other schools, like Wharton, request that professors keep average class GPAs below a certain number, ensuring that only a certain number of students will receive a perfect 4.0. How Important Are Grades in Business School? Before you begin worrying about grades too much, its important to note that GPA isnt really that important if youre an MBA student. Obviously, you want to be able to pass your class and do well, but when it comes down to it, MBA grades just aren’t as important as high school or undergraduate grades. Employers are willing to overlook soft grades for MBA grads who fit the company culture or excel in a particular area, such as leadership. If youre a student in an undergraduate business program, on the other hand, your GPA is important. A low undergraduate GPA can keep you out of a top-ranked graduate school. It can also affect your employment prospects, as employers are much more likely to ask about your class rank and success rate in a particular class. Tips for Getting Good Grades in Business School Determination is an important quality for all MBA students. Without it, you are going to have a hard time wading through the notoriously rigorous curriculum and keeping up with your cohorts. If you can keep your determination level high, your persistence will pay off with good grades or at least an A for effort - professors notice enthusiasm and effort and will find some way to reward it. A few other tips to help you get good grades in business school: Show up for class. You don’t need to attend every single class, but if you attend a small business program, your empty seat will be noticed. Since many business programs are teamwork-based, you will also be letting down your classmates when you do not pull your weight.Participate in class. Remember, participation can account for a large portion of your grade. If you don’t get involved in class discussion or at least look interested in class, you won’t fare well in a case-based curriculum or a course that emphasizes involvement.Learn to read fast. In two years of business school, you could read as many as 50 textbooks and 500 cases. Learning how to take in a lot of dry text in a short amount of time will save you time and allow you to focus on other work.Join or form a study group. Study group members can learn from one another. Making yourself accountable to a group can also keep you motivated and on track.Read case studies. A good case study/analysis combo is th e perfect way to learn how to answer questions in a business school class. If you know what topic you will be studying next week in class, prepare with a few case studies in private this week. Master time management. There is never enough time to get all of your work done in business school. The more you can learn and practice time management, the easier it will be for you to at least get to 90 percent of your work.Network with everyone. Grades are important, but networking is what will help you survive business school and thrive after graduation. Don’t sacrifice your time with other people for hours in the books.

Richard Roepers Response to the Dove ad Campaign Essay

Richard Roepers Response to the Dove ad Campaign - Essay Example By using the real woman rather than the slim and shaped woman, in the advertisement was a different dimension of beauty in the real woman. The traditional believe about a beautiful woman is one who is slim and has a figure and those who are different are regarded as ugly, plump or unattractive. Richard Roeper, a famous columnist, developed a criticism of the Dove ad Campaign and suggested that the whole issue was a bad and a dishonest and hypocritical idea. This essay supports the idea of Roeper that the Dove ad Campaign was unsettling and unsubstantiated. The Dove ad campaign was launched little after a research that showed that only 4% of women were bold enough to regard themselves as beautiful in public. The low percentage shows that women have developed an inferior regard of themselves and that this has undermined their public confidence. The launch of this new image of a beautiful woman was aimed at bringing about a new image of the women as part of the responsibility of the med ia to model the beliefs of the society. From this point of view, this campaign was part of the media’s effort to change the idea of the people concerning the beauty of a woman. In this campaign, Unilever printed the images of the average woman and defined this as beauty, images that most men regarded as rather plump and shapeless (Tavris 209-241).

American cinema Essay Example | Topics and Well Written Essays - 1750 words

American cinema - Essay Example Concerns of the 90s are also brought out in the film, including increased violence, changing rates and types of drug use and cultural oddities such as all over body piercings. Each character has their own perspective on the times in which they’re living as well, bringing in even more depth in Tarantino’s analysis of this era, which is brought out in even sharper detail thanks to the several references made to pop culture icons of bygone eras. It is through these various devices that Tarantino is able to deliver a film that not only captures the prevailing culture of 1990s America, but that also provides an answer for those seeking meaning in a confusing and violent world. Violence plays a big role in the film just as it did in everyday life in America in the 90’s. By the end of the decade, Americans had become used to acting as the world’s policeman, having worked singly and with other countries in a variety of predominantly Middle Eastern issues. However, the beginnings of this trend were already evident by the time the movie was released. Although he doesn’t make a comment upon these actions directly, Tarantino indicates his own feelings regarding war in the flashback Butch experiences just before he’s called to his fight. The character of Captain Koons enters the home where Butch as a young child is watching cartoons and gives him his father’s watch. While war is given a somewhat nostalgic, honorable memory in the story regarding Butch’s great-grandfather who went to war in World War I and his grandfather who died in World War II, the Captain takes on a whole new tone when discussing his own experience in Vietnam. Although his voice has been calm and gentle, almost sing-song as he relates the family history regarding the watch in his hand, he takes on a much harsher tone and introduces vulgar language in discussing how the watch was preserved to be passed down to Butch.

Importance of institutional investors for financial markets Essay

Importance of institutional investors for financial markets - Essay Example Such funds are prepared to get reinvested so as to attain the benefit out from investments. There are different types of institutions that manage and organize investments (Davis, 2001). Such include pension institutions, insurance companies, savings institutions and foundations respectively. All institutions are important with respect to the area of finance they manage and deal with. It is their specialized skill which recovers the benefit from the investment, as they are more aware of the market trends and regulations than the ordinary man - â€Å"a common investor† (Davis, 2001). Institutional investments like pension funds have a great role in developing economies. Pension funds mount up the amount and number of investments attained by company employers in respect of their employees. The amount gets doubled and tripled after some time, depending on the rates on which it has been fixed, and adds a consistent share in the financial stock market until the policy gets expired. This is how regulations, policies and instrumentations of pension funds (institutional investment) retrieve the best outcome (liquid assets) for both investors and managers of the fund. The importance of pension institution funds vary with respect to the changing norms of countries’ markets. According to International Financial Services London (IFSL) 2004, UK projects an amount of $1,400 billion in the pension funds prospect, adding a major share in the UK’s financial stock market (BGL, 2010).... Such institutions are caretakers of others’ equities and private holding investments. The role of institutions is deliberate as they set a system of organizing, developing and managing respective funds. Such funds are prepared to get reinvested so as to attain the benefit out from investments. There are different types of institutions that manage and organize investments (Davis, 2001). Such include pension institutions, insurance companies, savings institutions and foundations respectively. All institutions are important with respect to the area of finance they manage and deal with. It is their specialized skill which recovers the benefit from the investment, as they are more aware of the market trends and regulations than the ordinary man - â€Å"a common investor† (Davis, 2001). Institutional investments like pension funds have a great role in developing economies. Pension funds mount up the amount and number of investments attained by company employers in respect of their employees. The amount gets doubled and tripled after some time, depending on the rates on which it has been fixed, and adds a consistent share in the financial stock market until the policy gets expired. This is how regulations, policies and instrumentations of pension funds (institutional investment) retrieve the best outcome (liquid assets) for both investors and managers of the fund. The importance of pension institution funds vary with respect to the changing norms of countries’ markets. According to International Financial Services London (IFSL) 2004, UK projects an amount of $1,400 billion in the pension funds prospect, adding a major share in the UK’s financial stock market (BGL, 2010). The contribution of pension funds is there for Germany and France

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance The Expression of Long Non-coding RNA UCA1 in Human Ovarian Cancer Cells and Its Role in Cisplatin Cytotoxicity in Vitro Running title: UCA1 in cisplatin induced ovarian cancer cell resistance Highlights Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Abstract Objective: The therapeutic potential of cisplatin in ovarian cancer treatment is limited by the occurrence of cellular resistance. To explore the role of long non-coding RNA UCA1 in cisplatin induced ovarian cancer cell resistance. Methods: Twenty-four ovarian cancer tissues and sixteen normal tissues were used to assess the expression of UCA1 RNA. After expression UCA1 in SKOV3 cells, the cell migration, invasion and cisplatin resistance was assessed. Furthermore, the related mechanism was also explored. In addition, SRPK1 knockdown cell line was established and the effect of SRPK1 on cell migration, invasion and cisplatin resistance was also evaluated. Results: The increased expression of UCA1 RNA was identified in 24 ovarian cancer tissue compared with normal tissue. Expression of UCA1 RNA in SKOV3 cells increased the cell migration, invasion and cisplatin resistance. Alternated expression of SRPK1 and apoptosis related proteins were found in SKOV3/pcDNA-UCA1 cells. The effect of UCA1 expression on cell migration, invasion and cisplatin resistance was reversed by knocking-down SRPK1 in SKOV3 cells. Conclusions: Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Key words: Long non-coding RNA, UCA1, SRPK1, cisplatin resistance, cell migration, invasion Introduction Ovarian cancer is the second most commonly diagnosed gynecological cancer in the world, and causes more deaths per year than any other the female reproductive system related cancer(1). More than 200,000 cases are newly diagnosed and 120,000 women die of ovarian cancer annually all over the world(2). Platinum based chemotherapy is active in ovarian cancer treatment. However, intrinsic or acquired cellular resistance to cisplatin is encountered regularly and severely limits the therapeutic potential of the drug(3). Multiple biological processes, such as dose accumulation, metabolism, apoptosis, DNA damage, are involved in the mechanisms of cellular resistance(4). Conquering cisplatin resistance remains therefore a critical goal for anticancer therapy and considerable efforts have been undertaken to solve this problem throughout the past three decades. Previous studies have shown that serine/arginine-rich protein-specific kinase 1(SRPK1) and apoptosis related protein are closely related with cisplatin resistance. SRPK1 is a kinase which belongs to SR kinase family (5). Through regulating the phosphorylation of SR splicing factors, SRPK1 can afftect the pre-mRNA splicing and consequently gene expression (6). Increasing attentions have been paid on the role of SRPK1 in cisplatin resistance(7-8). The apoptosis resistance induced by anticancer drug treatment has been suggested as another important mechanism in cellular resistance(4). More and more studies have shown that abnormal expression of long non-coding RNA (lncRNA) is involved in tumor development and progression(9). In a previous study, we obtained lncRNA UCA1 using RACE and found that higher expression of lncRNA UCA1 in bladder tumor tissues than normal tissues(10). Here, we tried to assess the expression of UCA1 and SRPK1 in ovarian cancer tissue and normal tissue using RT-PCR and explore the role of UCA1 in cisplatin induced ovarian cancer cell resistance. Our results might provide theoretical basis for chemotherapy selection in clinic and a novel cisplatin resistance related target was also suggested. Methods and materials Cell culture, Patients and Ovarian tumor specimens The human ovarian cancer cell line SKOV3 was maintained at 37 °C and 5% CO2 incubator in RPMI-1640 media with 10% fetal bovine serum, 100 U/ml penicillin, and 100  µg/ml streptomycin. Flash frozen tissue specimens (n= 40) were obtained from patients undergoing debulking surgery for ovarian cancer at People’s hospital of Shaanxi Providence, Shaanxi, China from January 2010 to January 2013. Among the specimens, epithelial ovarian cancer (n=24) were obtained from primary lesion of the patients without radiochemotherapy while normal ovarian samples (n= 16) were obtained from patients undergoing hysterectomies for benign conditions. The pathological examination on all tissues was confirmed by two experienced physician. Written consent was provided by each patient and the whole protocol was proved by the Review Board of the hospital. Reverse transcription PCR analysis Total RNA extraction of cancer tissue or cells were performed with Trizol (Life Tech, US) and the reverse transcription reaction were performed with ImProm II reverse transcriptase(Promega, US) according to the manufacturer’s instruction. UCA1, SRPK1, 18S rRNA specific sequences were amplified during 30 cycles of 30 s denaturing at 95 °C, 60 s annealing at 57 °C, and 60 s extension at 72 °C, with the primers listed in Table 1. Table 1 Primer sequences used in the study Name Forward primer Reverse primer UCA1 CTCTCCATTGGGTTCACCATTC GCGGCAGGTCTTAAGAGATGAG SRPK1 TAACGGACCACTGGACAACAAA TTCCTGCGACCACTCATACTTC 18S rRNA CAGCCACCCGAGATTGAGCA TAGTAGCGACGGGCGGTGTG UCA1 (full length) CGGGATCCTGACATTCTTCTGGACAATGAG CCGGAATTCGCATATTAGCTTTAATGTAGGTGGC Expression of UCA1 in SKOV3 cells The full length of UCA1 was expanded by PCR (The primer was showed in Table 1) at an annealing temperature of 53  °C. After digested with BamHI and EcoRI, the PCR fragment was subcloned into pcDNA3.1 to construct the pcDNA-UCA plasmid. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US). Twenty-four hours later, G418 selection(500  µg/mL) was processed for 3 weeks. The characterization of the positive clone was confimed by RT-PCR. The pcDNA3.1 without UCA1 fragment was used as negative control. RNAi The shRNA sequences of SRPK1 were obtained according to previous description(11). SH1 and SH3, encoding shRNA targeting nucleotides 1423 to 1443 (GGTCAGTCATTCAGTGAACAA) and 288 to 308 (CAAGAAGATCCTAATGATTA), respectively, of the SRPK1 mRNA, were processed with annealing, subcloning into PRNAT-U6.1/Neo plasmid (GenScrpt Corp., Piscataway, NJ, US), plasmid expansion and media amount extraction. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US) and 3 different batch of cells were used for knockdown efficacy examination. Stable cell lines were obtained by G418 selection for 3 weeks. The expression of SRPK1 was confirmed by western-blot analysis. Western-blot analysis The frozen myocardial tissues were lysed in RIPA buffer (Beyotime, China), followed by high speed centrifugation and BCA quantification. Cellular protein was separated by electrophoresis on SDS-PAGE gel and then transferred onto PVDF membrane. After blocking, the blots were incubated with the antibodies to SRPK1 (BD), Bcl-2 (Cell Signaling Technology), BAX (Cell Signaling Technology), caspase-3(Cell Signaling Technology), aspase-3(Cell Signaling Technology). And ÃŽ ²-Actin(Cell Signaling Technology) was used as loading control. The appropriate HPR conjugated secondary antibodies were applied. The protein bands detected with SuperSignal Ultra Chemiluminescent Substrate (Pierce) on X-ray films (Koda). MTT After preparing the single cell suspension, 4Ãâ€"103 cells in 100 ÃŽ ¼L culture media were seeded in 96-well plate in quadruplicate overnight. MTT was added for 4 hr, and formazan dye was dissolved with DMSO and read at 490 nm in a microplate reader (Molecular Device, US). All the experiments were performed for three times. Clonogenic Survival Assay Cells (5Ãâ€"102) were seeded in 6-well plates overnight and incubated with RPMI1640 + 10%FBS + 500 ÃŽ ¼g/ml G418 for 14 day. After removing the media, cells were washed with PBS, fixed with 95% ethanol for 30 min and stained with Giemsa for 15 min. Colonies with >50 cells were counted under microscope. Percentage cell survival is expressed relative to untreated control. Scratch assay 3.0Ãâ€"105 cells were seeded in 6-well plates and the cells were allowed to grow until 90% confluence was reached. Then the cells were grown in 0.2% FBS RPMI1640 media overnight for resting and a scratch was made by using the 200 ÃŽ ¼L pipette tip. The photos were taken at 0 h and 24 h under a microscopy and the relative migrating distances of the wound areas were measured on the images. 3-D migration and Invasion assay Cells (5Ãâ€"105) were seeded in triplicate in upper chamber of the Millicell (8 ÃŽ ¼m pore diameter) which was pre-coated with Matrigel (Becton Dickinson Labware, Bedford, MA). After the lower chamber of the Millicell was added with 900 ÃŽ ¼L RPMI 1640 +20% FBS, the Millicell was incubated at 37 °C and 5% CO2 for 24 hrs. Then the Matrigel was removed by cotton tip, fixed with 95% ethanol for 30 min, stained with Giemsa staining. The membrane was checked with microscopy. The migration assay was similar with invasion assay but with 12 hr incubation time. Cisplatin resistance assay Cells (3Ãâ€"104) were seeded in quadruplicate in 24-well plate and allowed to adhere overnight. Then the cells were treated with serious concentration of cisplatin(0,2.5,5,10, 20,40,80 ÃŽ ¼M) for 48 hr. Cell viability was determined by MTT assay at 490 nm wavelength. Statistical analysis All statistical analyses were performed using the SPSS13.0 software. The results were presented as means  ± SD. Two-tailed Student’s t-test was used to examine the differences between groups. P Results The expression of UCA 1 RNA and SRPK1 mRNA in ovarian tissues Twenty-four ovarian epithelial cancer tissue and sixteen normal ovarian tissue was used to assess the UCA1 and SRPK1 expression. And we found higher expression of UCA 1 RNA and SRPK1 mRNA in ovarian cancer tissue while no significant expression of UCA1 and SRPK1 was found in normal ovarian tissue(Figure 1A). The effect of UCA1 RNA expression on SKVO3 migration and invasion Cell lines establishing After constructing of pcDNA-UCA1, the stable cell lines with or without UCA1 RNA expression were established. The positive control was confirmed by RT-PCR and the result showed that a length of 1442 bp UCA1 RNA was expanded from SKOV3/pcDNA-UCA1 while no UCA1 was found in negative control SKOV3/pcDNA 3.1(Figure 1B). 2-D and 3-D Migration and invasion assay The scratch assay suggested that cell migration ability of SKOV3/pcDNA-UCA1 was significantly increased that of SKOV3/pcDNA 3.1(Figure 1C). The 3-D migration and invasion assay with millicell chamber showed that the migration and invasion abilities were significantly increased in SKOV3/pcDNA-UCA1 cell than SKOV3/pcDNA 3.1 cells(Figure 2A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pcDNA-UCA1 cell. The IC50 of SKOV3/pcDNA-UCA1 cells increased 2.41 times than that of SKOV3/pcDNA 3.1 cells(Figure 2B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 cells (Figure 2C). The effect of SRPK1 knockdown on SKOV3 cells Knockdown cell line establishing The knockdown efficacy of pRNAT-SH1 and pRNAT-SH3 were firstly examined by transient transfestion and western-blot. And the results showed that SKOV3/ pRNAT-SH3 was extend a better effect of knocking down SRPK1 (Figure 3A1). Stable cell lines of SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 were also established and the effect of pRNAT-SH3 on SRPK1 knockdown was showed in Figure 3A2. The proliferation, colongenic, migration, invasion abilities of SRPK1 knockdown The result of MTT assay was showed that decreased proliferation was found in SKOV3/pRNAT-SH3(Figure 3B). The colongenic ability of SKOV3/pRNAT-SH3 was significantly decreased than that of SKOV3/pRNAT-U6.1(Figure 3C). The 3-D migration and cell invasion assay showed that the cell migration and invasion were decreased in SKOV3/pRNAT-SH3 cells than SKOV3/pRNAT-U6.1 cells(Figure 4A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pRNAT-SH3 cell. The IC50 of SKOV3/pRNAT-SH3 cells was increased 2.64 times than that of SKOV3/pRNAT-U6.1 cells(Figure 4B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 cells (Figure 4C). Discussion The lnc RNA UCA1 was cloned in our lab using SMAT-RACE from the bladder cancer cell line BLZ-211. And UCA1 RNA showed an expression pattern of increasing expression in early stage of human embryonic development, differential expression at 28 week of embryonic development, no expression in normal adult tissues. However, the expression of UCA1 RNA was increased in bladder cancer tissues(10). In addition, the increasing expression of UCA1 RNA than the normal or para-carcinoma tissueswas also found in breast cancer, liver cancer, thyroid cancer, cervical cancer, lung cancer, esophagus cancer, gastric cancer and so on(12). We didn’t observe an obvious expression of UCA1 RNA in normal tissues and did observe the expression of UCA1 RNA in ovarian cancer tissues. This suggested UCA1 RNA may extent a critical role in the development and progression of ovarian cancer. The previous study showed that the abilities of cell proliferation, cisplatin resistance, invasion and migration were increased in bladder cancer cell line(13). Yang et al showed that UCA1 can regulate the cell cycle through CREB and PI3K pathway(14). Wang et al found that overexpression of UCA1a(also named as CUDR) in bladder cancer cells would increase the abilities of cell proliferation, invasion and cisplatin resistance and decrease cell apoptosis(15). Wing et al showed that increased expression of UCA1a could increase the cellular resistance and decrease the apoptosis in A431 squamous cancer cells. However, the mechanism is still unknown(16). The cisplatin resistance of ovarian cancer is the main cause of tumor recurrence and the failure of chemotherapy. The mechanisms of cisplatin resistance included dose accumulation of the drug, metabolism, apoptosis and DNA damage and it is a complicate process of multi-factor, multi-level and multi-gene. SKOV3 was used to assess the cisplatin resistance effect in ovarian cancer. We established SKOV3 cell lines expressing UCA1 RNA and found that cell abilities of migration, invasion and cisplatin resistance were increased, which was consistent with the results obtained from the bladder cancer cell lines. Since SRPK1 was proved to involve in the cisplatin resistance(17-18), we also tried to analyze the association between UCA1 RNA and SRPK1. And the western blot results showed that increased expression of SRPK1 and Bcl-2 while decreased expression of Bax, Caspase 3 and Caspase 9. SRPK1 is specific kinase belonged to SR family. It can specifically phosphorylate the SR splice factor and regulate the gene expression by alternative splicing of pre-mRNA of target gene(6). Hayes et al found decreased expression of SRPK1 in pancreas, colon and breast cancer could lead to increasing and decreasing expression of Bcl-2 and Bax. The decreasing on cell proliferation and increasing on cell apoptosis were found (19). Furthermore, increased sensitivities of Gemcitabine and Cisplatin were also found (11, 19). In order to confirm whether SRPK1 is involved in the mechanism of UCA1 regulating ovarian cancer proliferation and migration, we employed RNAi to decrease the expression of SRPK1 and found that increased expression of Bcl-2 and decreased expression of Bax, Caspase 3 and Caspase 9 after downregulating the expression of SRPK1. In addition, we found the increasing abilities on cell proliferation, migration and invasion after SRPK1 knockdown. In conclusion, we found UCA1 RNA may increasing of cell proliferation, decreasing apoptosis and lead to the cisplatin resistance by increasing the expression of SRPK1 and affecting the expression of apoptosis related proteins(such as Bcl-2, Bax, Caspase 3 and Caspase 9). Our results will add novel insight on cisplatin resistance and provide novel molecular target to the treatment.

Newman And The English Major :: essays research papers

Newman and The English Major John Newman’s ideas of education, knowledge, and intellectual fitness are well-formed and truthful. As related to my major, English, it reveals some interesting trends and practices. Although the English major isn’t a real big money-maker, like being a lawyer or doctor, and it generally focuses on literature and creativity, the courses still concentrate on the utility of what is being learned. Although one can sometimes see the relationships between courses, and thereby understand them in respects to each other and draw some connection, this interaction is rarely stated explicitly in those courses. One of Newman’s key ideas is that liberal knowledge (knowing how to think with versatility) is necessary for the more effective and more adaptable use of particular knowledge. A class that has allowed me to think and learn in this way was ENG 3014, Theories of Literature. I took the class twice for the purpose of raising my grade; the first time with Dr. Campbell and the second time with Dr. Logan. In this class I learned various critical literary theories and how to apply them to any text, communication, or other form of expression. Although these theories are based on application, it is the application of a thought process; an analysis which can be adapted and imposed on whatever I choose, which I can choose at my leisure, not just useful in one specific situation. However, most classes only teach facts, lessons, and the direct applications for them. Even the general studies courses and survey courses are taught as thought all the knowledge taught were to be used, not knowledge to savor and help heighten the intellect or thought process. To get an Associate’s degree for example, one must fulfill certain requirements, such as â€Å"natural science.† Instead of the class being taught as a class on general knowledge, which would be insightful into the world around us, they are taught as though every student enrolled were interested in becoming a chemist or biologist, with not enough effort placed on stimulation of interest. The students who are not interested in pursuing the sciences further have no use for this â€Å"particular† information, and it is disused and forgotten. I know that there are all sorts of information that I’ve been taught but are too specific to be useful to me day-to-day and so have been forgotten. The problem is that particular knowledge is useless except in one particular realm or level of discourse.

I Love School Essay

Doors and windows -It is suggested to use wooden door and window frames instead of concrete or steel. Framing Timber framing -naturally sound insulated -strong structure -construction times are less Recycled steel framing -It’s easy to use when contractors are building your house -less framing material compared to wood but will still be the same structure if you used wood. -Walls, roof and ceilings will not change due to the weather changes -they do not rot, absorb moisture or create mould -resistant against termites Roofing Cool roofing -once the product is painted onto your roof the sun is reflected away. it can be painted on wood, concrete, plaster, metal and glass. -when it’s hot it is preferred that you wear white instead of black, cool roofing is where it reflects the sun and stays cooler because it’s a white colour -cost more than normal roofing but once it starts to work it lowers your bill. -having the roof that you probably have on your house now can re ach temperatures of over 70 degrees storing more heat into your house, cool roofing’s temperature only goes to 20-35 degrees at most without insulation leaving your house cooler and saving you from paying heavy cooling bills. Authentic roof made from recycled materials -been said that it’s virtually unbreakable -they are extremely light weight -has UV protection which stops it from fading -contains no toxin materials Roof tiles -colour will not fade, rust or corrode -are a natural thermal insulator. In winter they keep the cold air out and the heat in. In summer they keep the heat out and cold in -natural sound insulator -they are heat resistance; therefore they provide protection against bush fires -made with naturally occurring clay which can be recycled into new clay tiles and bricks Insulation Spray foam insulation -75% noise reduction reduces mould and condensation growth -saves on electricity bills Structural insulation panels -50% more energy efficient -40% less construction time -the core of the panels is made of Expanded Polystyrene which is made from using a low-environmental process which means it does not contain any major carbons. The Oriented Strand Board which is an engineered wood product is made from harvesting a fast growing crop forest which makes the materials renewable and sustainable. -fire resistant -can be used for floors, foundations and basements -bricks and stone can be installed on the panels SIP’s are also used as walls although you can put stone, or brick over the top of it. There is no need for painting as SIP’s come in a range of colour. recycled denim -made from old jeans that have been cleaned, stripped and covered in boric acid which is mould, fire and insect resistant -doesn’t contain any throat or skin irritations -creates a greater sound barrier -its 100% recyclable -requires small amount of energy to manufacture -doesn’t itch and easy to handle -when the insulation gets wet its manufactured to breathe and release the moisture. Also contains active mould inhibitors recycled paper 100% recyclable -takes 10 times less energy to produce than half of the other insulation -non-corrosive -doesn’t support mould or fungus growth -it reduces overheating and overcooling also good for sound insulation Heating/cooling Solar smart breeze -collects solar energy from under a tile or timber roof and cools the house in summer and heats it in winter Spilt system -energy efficient when compared to portable and window air conditioners Hyd ronic heating -uses radiant warmth. Evaporative cooling -uses natural air Smartbreeze -reduces 40% greenhouse gases -saves energy and electricity bills can also work at night providing nocturnal cooling how it works with a metal roof heating. During winter and cold days there can be a build-up of warm heated air between the roof, sheets and foils. The air is dragged to the smartbreeze unit and the fan energised by the solar panel that’s placed on your roof force the warm air through ceiling vents and into your living spaces creating a warmer environment. Cooling during the day during hot weather hot air builds up into your roof. The solar energised fans force the now cold air into your living space which then reduces the temperature. Roof ventilation Avoiding a build up of moisture in winter and to reduce an excessive heat build up in the summer -Some benefits are – lowing energy bills, greater comfort in home, ensure the health of your family -Removes dust which enters through tiny gaps of the house structure increasing your health. Gardening fake grass Regal grass -100% recycled -Contains no harmful toxins or heavy metals -no infill like sand is needed for the insulation -not spiky like real grass, soft to touch and walk on -doesn’t need to be mowed, therefore low maintenance is needed. There is no need to sweep away the excess grass that’s left over. Termiturf -no watering, mowing or fertilizing -its low maintenance -doesn’t lose colour or fade real grass -Needs to be watered at least once a week -Needs to be mowed, the petrol from the lawn mower pollutes the air -Needs to be fertilized, using fertilizer is bad because the chemicals that are in it get washed into either, rivers, oceans and lakes. That causes algae to grow and creatures that live in the water or drink the water. grey water -grey water is collected from you shower, bath or washing machine, it is then diverted into a pump called the waste water system, once the water flows hrough the pump it is then diverted into your garden. -it can save up to 350-700L per day -less energy and chemical use -lower water bills Drip irrigation -weed growth is reduces because between plants the areas aren’t irrigated -constant moisture which improves growth in plants -you don’t need to move them around like a sprinkler, they can stay there permenately -decreased fe rtilizer cost -60% more efficiency over sprinkler systems Flooring Cork flooring -made from trees. The trees are not cut down, they are made from the bark which grows back every 3 years -cork flooring contains a low or no VOC (volatile organic compound).

How to Overcome Hardship and Be Successful [Video]

How to Overcome Hardship and Be Successful [Video] Life can be tough, with lots of roadblocks that stand in the way of your success. The majority of us go through life with our noses to the ground, grinding through one day after the next filled with to-dos. We’re always in a hurry. But what might happen to our state of mind if, just sometimes, we†¦ stopped. What if we looked up to appreciate the beauty of what lies around us every day without us even noticing it? Check out the following TED Talk by Gavin Pretor-Pinney on how you, too, can use what lies around us to calm the stress within.

Bloggercise Your Writing

Bloggercise Your Writing Probably the best writing advice I ever received was this: Keep a Blog. Let me share with you a few reasons why and how my blog has helped me begin earning as a freelance writer. In my former life as a music teacher I found that the best musicians were those that didn’t just practise their scales and pieces the most; they were the ones that listened to music too. Both things are essential exercise for the musician. Writing is the same. Your ‘scales’ are the articles, books, stories and poems you write; your ‘listening’ is the literature you read. The old saying is true: a writer is a reader first. Keeping a blog helped me practise my ‘scales’ to develop my technique and my ‘listening’ was the hundreds of blog posts I’ve read as I mingled in the blogging community. I discovered what was popular, what was en vogue and what worked for me. Here’s a summary of just how my blog has helped develop my craft:   Ã‚     Experimentation Although my blog, kenthinksaloud, is primarily about Bangladesh where I work for a charity organisation as a teacher, I played with all sorts of ideas many of which have become lucrative for me. For instance, I started posting book reviews after enjoying some books with my kids. I had one accepted   Ã‚     Deadlines Keeping deadlines with editors is a big deal. For a while I made myself write three posts a week, each with a self-imposed word count, even when I didn’t feel like it just to practise meeting deadlines. Now I’m getting plenty of paying gigs, I’ve reduced it to once a week but after writing hundreds of posts, dashing off 500 words is a breeze now!   Ã‚     Finding an audience My main topic is something of a specialist interest, but as I explored ideas I was surprised which subjects were very popular. My son and I both have ADHD and writing about this provoked huge response. I am now submitting articles about ADHD to editors.   Ã‚     My blog sells me Several of my articles and stories, re-written from the blog, have been published So, I recommend bloggercising for you today. You can read what’s out there, try a variety of styles for yourself, practise meeting your own deadlines, build an audience as you learn what’s popular and then turn those winning ideas into paying articles and maybe even books that catch the eye of publishers. And if nothing else, bloggercise is fun and good for you. Give it a go – you never know where your posts might take you!

Globalisation and business enterprise Essay Example | Topics and Well Written Essays - 1500 words - 2

Globalisation and business enterprise - Essay Example ANZ has on offer a wide range of financial related products and also services. The bank has a global presence. The bank has branches in Asia, United Kingdom, Europe, the Pacific region, and also in the United States. It is considered as one among world’s 100 largest banking organizations. Global recession is said to be a period of time when global economy slows down considerably. In the recent times, the world economy entered into recession since the year of 2008. Due to crisis occurring because of sub-prime scenario the trade of both goods and assets decreased throughout the world. Business cycle related correlation had increased during the sub-prime crisis. Due to this trade of goods as well as GDP relative financial openness also increased. But the needed change in allocation of this goods and trade was not properly correlated with the shifting of the business cycle synchronization. Due to this scenario through out the world the global economic has seen a severe decline and for this reason the world’s financial situation has been affected in almost every sector (Imbs, 2009). ANZ National Bank in New Zealand has an omnipotent presence in the lives of people of the country. It has touched their lives through a wide range of scenario. It is one of the highest profit and asset making companies of the country. They have around 9,000 employees in the bank through out the country. The bank is a financial source for home loans. It also generates Gross Domestic Product (GDP) for the country’s economy. It has associated itself with charitable events and also other events of sponsorship (ANZ National Bank Limited, 2010). In the present day, globalization has changed the way business is done. It has made business organizations to think of global trade and potential of growth in the overseas market. It is considered that global trade has a possibility of changing the standard of living of people by improving

Criminal court process in United Kingdom Essay Example | Topics and Well Written Essays - 2500 words

Criminal court process in United Kingdom - Essay Example After being arrested, you are charged with a crime hence you will be booked for appearance in a court of law. The charge sheet will contain the offence that one is charged with. I f the charge has different counts; this will also be reflected therein.   Being booked in usually involves being photographed, fingerprints taken, and disclosure of personal information. The officials will then add your name and the crime committed into the official police record. Personal belongings will be taken from you and kept safely until you come out of custody. You will be asked to sign an inventory after this. Court/ TrialLargest percentages of criminal cases get adjudicated in the magistrate’s court.   A children’s court exists as a type of a magistrate’s court (Banks, 2013.p7.). In the magistrate courts, there are exists three magistrates although at times the case is adjudicated by a single magistrate (Criminal Prosecution Service).   Then there are crown courts that a djudicate fewer cases and the cases referred to this court involve;†¢Ã‚  Instances where the accused has intimated that their case be adjudicated by that court†¢Ã‚  Cases referred by magistrates because of the gravity of their sentence, which cannot be passed in the lower court.The other set of courts involve the Court of appeal that may adjudicate appeals emanating from the crown’s court. The other set of court is the House of Lords. Judges in these courts have to ensure that they take up their tasks expeditiously to ensure that they bestow justice to every person.